free counters
100 Blog Indonesia Terbaik
ACCU BEKAS

ACCU BEKAS

Kamis, 07 Mei 2009

DEFENSIVE DRIVER BEHAVIOUR

Tujuan DDB adalah untuk menghindarkan terjadinya kecelakaan kendaraan

bermotor dimanapun dan kapanpun.

Keselamatan adalah kunci sukses anda bekerja, tidak ada arti yang lain jika

anda mendapatkan kecelakaan dalam bentuk apapun, karena setiap

kecelakaan menimbulkan kerugian baik phisik maupun non phisik.

Maka untuk itu anda diharuskan mematuhi semua aturan-aturan yang

berhubungan dengan Keselamatan Kendaraan Bermotor yang berlaku di

daerah kerja Perusahaan seperti berikut;


A. Surat Izin Mengemudi

Hanya pegawai yang memiliki surat izin mengemudi (SIM) saja yang diizinkan

untuk mengendarai kendaraan bermotor perusahaan dan kendaraan.


B. Tanggung Jawab Pengemudi

1. Mengemudi tanpa kecelakaan untuk urusan Perusahaan merupakan kunci

tanggung jawab tugas. Hal ini merupakan sikap seorang pengemudi profesional.

a) Seorang pengemudi profesional harus bersikap sempurna untuk menjaga

agar pada setiap perjalanan tidak terjadi kecelakaan, tidak ada hampir terjadi

kecelakaan, tidak ada pelanggaran lalu lintas, tidak ada keterlambatan, tidak

ada kerusakan mekanis yang disebabkan oleh kelalaian mengemudi.

b) Sikap seorang pengemudi profesional dibuktikan dari tanggung jawabnya

terhadap yang berikut:

− melakukan pemeriksaan pra-perjalanan atas kendaraan dan peralatan

darurat

− menjaga keselamatan penumpang, termasuk penggunaan sabuk pengaman

oleh setiap orang,

− melaporkan kerusakan untuk dilakukan perbaikan,

− merencanakan rute,

− mematuhi undang-undang lalu-lintas, dan

− menjadi pengemudi yang defensif.

c) Mencegah terjadinya kecelakaan walaupun cuaca buruk, kesalahan orang

lain, keadaan jalan yang buruk dll.


2. Pengemudi kendaraan Perusahaan juga bertanggung jawab atas keselamatan

pegawai yang membantu memunggah atau menurunkan muatan, atau mereka

yang bekerja diatas atau di sekitar kendaraan.


3. Semua pengemudi harus mengikuti kursus mengemudi defensif, ikut serta

dalam program penjelasan serta mengikuti kursus penyegar setengah hari

setiap dua atau tiga tahun sekali.


4. Pengemudi bertanggung jawab terhadap akibat pelanggaran.






5. Pengemudi CPI harus melakukan pemeriksaan pra-perjalanan mengenai:

a. Registrasi kendaraan yang masih berlaku

b. Prosedur kecelakaan / perbaikan

c. Kondisi dan operasi setiap bagian kendaraan


6. Pengemudi tidak diizinkan mengoperasikan peralatan perusahaan yang rusak

atau tidak menurut undang-undang.


C. Prinsip-Prinsip Mengemudi Defensif

Semua pengemudi harus mengikuti teknik dan taktik mengemudi dengan defensif

berikut:


1. Sasaran Sempurna Dalam Mengemudi

a) Memandang berulang-ulang dalam zona rencana (30 detik + ke depan)

b) Memandang dengan konsisten selama 15 detik.

c) Melihat ke depan untuk mengantisipasi masalah.

d) Mengurangi kecepatan karena sasaran berkurang oleh kepadatan lalu-lintas,

tikungan, bukit, kabut, malam, hujan, dll.

e) Menjaga kendaraan agar tetap berada ditengah.


2. Usahakan Pandangan Yang Lebih Luas

a) Jarak mengikuti dari belakang yang baik: 4-6 detik dalam kondisi ideal; lebih

lama waktunya jika jalan basah/licin; lebih lama ketika dikuntil dari belakang.

b) Jarak mengiring yang cukup memberi kesempatan bagi mata untuk

memandang semua yang ada di sekitar kendaraan.

c) Membuat keputusan lebih awal.


3. Terus Melihat Sekeliling - Pada Ke-empat Sisi Kendaraan Plus

a) Gerakkan mata minimal setiap 2 detik.

b) Lihat kaca spion setiap 5 - 6 detik.

c) Perhatikan simpang sebelum masuk.

d) Hindarkan menatap lama-lama (staring) ketika menilai situasi (berhenti,

kurangi kecepatan, ubah posisi, lihat ke arah lain, bunyikan klakson)

e) Jarak mengiring yang cukup merupakan kunci untuk memperoleh waktu

mengerakkan pandangan.


4. Usahakan Siaga Penuh

a) Dekati persimpangan dengan mengurangi kecepatan hingga merasa pasti

untuk dapat masuk dengan aman dan bersiap untuk berhenti.

b) Dekati sebagian besar persimpangan, terutama persimpangan yang

terhalang, dengan meletakkan kaki pada pedal rem.

c) Jaga jarak sekeliling kendaraan dibahagian depan jika terjepit di tengah-

tengah.

d) Sesuaikan kecepatan untuk menghadapi tindakan pengemudi lain.

e) Pertahankan jarak mengiring yang tepat.

f) Tanya diri sendiri “Bagaimana jika ……? Bersiap-siap untuk menghadapi

tindakan orang lain, keadaan jalan, dan cuaca.

g) Ketika berhenti, jaga agar ada jarak satu kendaraan ke depan.

h) Patuhi peraturan mundur yang aman.




5. Pastikan Bahwa Mereka Melihat Anda

a) Komunikasikan keberadaan dan maksud anda kepada orang lain: bunyikan

klakson, gunakan lampu jauh, lampu rem dan tanda dengan tangan tangan.

b) Pandang mata pengemudi lain dan para pejalan kaki.

c) Hidupkan lampu jauh pada siang hari, terutama pada jalan dua jalur. Hal ini

membantu orang lain untuk melihat anda.

d) Ambil jalur yang benar jauh-jauh hari.


D. Memulai dengan Aman

Pengemudi kendaraan Perusahaan harus berjalan sekeliling kendaraan sebelum

menghidupkan kendaraan tersebut untuk memeriksa kemungkinan adanya

penghalang atau kondisi yang tidak menguntungkan.


E. Mundur dengan Aman

Hindari kecelakaan waktu mundur dengan mempraktekkan prinsip-prinsip

mengemudi defensif berikut:

1. Jika mungkin, JANGAN MUNDUR.

2. Jika masuk fasilitas atau lokasi lapangan, usahakan parkir dimana anda tidak

perlu mundur. Kecuali jika parkir di tempat parkir yang telah ditentukan.

3. Jika pada fasilitas/lokasi ada larangan berputar tanpa mundur, parkir pada jalan

raya dan masuk ke fasilitas dengan berjalan kaki.

4. Posisikan kendaraan anda agar gerakan awal anda nantinya adalah maju ke

depan.

5. Rencanakan parkir anda agar anda dapat maju ke depan jika berangkat nanti.

6. Jika aman, mundurkan kendaraan anda pada tempat parkir agar anda dapat

maju ketika siap untuk berangkat nanti.

7. Jika gerakan awal anda harus mundur, periksa di sekeliling kendaraan anda

sambil berjalan untuk memastikan bahwa ruangan tidak ada penghalang.

8. Mulai mundur dengan segera.

9. Mundur perlahan-lahan.

10. Gerakkan pandangan anda: gunakan kaca spion, lihat keluar jendela, dan putar

tubuh anda untuk melihat keluar melalui jendela belakang jika mungkin.

11. Mundur secukupnya saja sebelum dapat maju.

12. Bunyikan klakson atau gunakan alat lain untuk memastikan bahwa orang lain

melihat anda dan tidak akan bergerak ke ruangan yang anda tuju.

13. Gunakan pemandu jika perlu. Pastikan bahwa pemandu tersebut berdiri di

tempat yang aman, dan anda setuju dengan aba-aba tangan yang dibuatnya,

serta anda berdua saling berpandangan.

14. Sekali lagi, jika mungkin JANGAN MUNDUR!!!







F. Memarkir dengan Aman


1. Jangan parkir di belakang kendaraan lain atau dengan posisi yang menempatkan

kendaraan anda “tidak kelihatan ”oleh pengemudi kendaraan lain.

2. Kendaraan harus diparkir di pinggir jalan yang tidak menghalangi lalu-lintas dan

kendaraan lain.

3. Pintu harus ditutup.

4. Mesin dimatikan.

5. Pastikan bahwa transmisi pada posisi ”parkir” dan pasang rem tangan.

6. Untuk kendaraan yang diparkir pada penurunan dan pendakian:

a. Roda depan dihadapkan dengan benar ke trotoar atau pinggir jalan, dan

b. Pick-up dan truk, yaitu untuk operator lapangan, juru las, dll., roda belakang

harus “dihambat” dengan benar.

c. Pasang rem tangan.

7. Untuk kendaraan tanpa rem angin atau listrik, tidak dijaga:

a. Pasang transmisi otomatis pada posisi “parkir” atau transmisi standar pada

“gigi rendah” berlawanan dengan arah pendakian, serta

b. “Matikan” mesin,

c. Pasang rem tangan,

d. Hambat roda belakang.

8. Untuk kendaraan dengan rem angin atau rem listrik dengan power take-off:

a. Pasang rem tangan dan rem mikro (jika ada), dan

b. Hambat roda belakang dengan benar.

9. Untuk kendaraan dengan rem angin atau rem listrik, tidak menggunakan power

take-off - tidak dijaga:

a. “Matikan” mesin, dan

b. Pasang transmisi pada “gigi rendah”, dan

c. Pasang rem tangan atau rem mikro (jika ada).


G. Penggunaan Sabuk Pengaman

Pengemudi dan penumpang harus memasang sabuk pengaman mereka jika

mengendarai kendaraan perusahaan. Pengemudi bertanggung jawab atas

pemakaian sabuk pengaman oleh penumpang.


H. Pengoperasian yang Aman

1. Perkakas, peralatan, kertas, dll. tidak boleh dibiarkan berserakan dalam ruangan

truk atau ruangan penumpang. Gunakan chart holder atau clipboard untuk

kertas.

2. Memuat Barang

a) Truk atau kendaraan lain tidak boleh dimuat dengan beban melebihi batas

berat untuk barang atau penumpang yang telah ditetapkan.

b) Semua muatan kendaraan harus disusun rapi dan diikat, dan bagian belakang

yang menonjol 4 (empat) kaki melebihi badan kendaraan harus diberi

bendera merah.

c) Bahan peledak, racun serangga, cairan yang mudah menyala dan mudah

terbakar harus diangkut dalam kemasan yang aman diluar ruangan

penumpang. Semua persyaratan undang-undang untuk kemasan, plakat,

label, dll.harus dipatuhi.

d) Jika terjadi kerusakan, kendaraan harus diparkir diluar jalur jalan raya jika

mungkin.

e) Jika kerusakan terjadi dalam jarak 500 kaki dari tikungan, punggung bukit

atau penghalang pemandangan lain, pengemudi harus meletakkan tanda atau

alat peringatan (mis. segitiga merah atau alat yang bercahaya) ke arah yang

memberi peringatan kepada lalu-lintas. Alat pemberi peringatan harus

diletakkan tidak kurang dari 100 kaki atau tidak lebih dari 500 kaki dari

kendaraan yang rusak.


3. Penumpang

Penumpang harus diangkut pada tempat duduk yang telah ditentukan yang

dilengkapi dengan sabuk pengaman atau alat pengaman lain.


4. Telepon genggam.

Telepon genggam tidak boleh digunakan atau menjawab panggilan oleh si

pengemudi sewaktu kendaraan sedang berjalan. Pengemudi harus berhenti

keluar jalan sebelum menggunakan telepon genggam.

Label: , , , , ,

Selasa, 05 Mei 2009

Flu Singapura (PENYAKIT)

FLU SINGAPURA - HFMD - KTM
"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.
EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).
Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.
GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :
o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.
Komplikasi penyakit ini adalah :
o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )
Satu kelompok dengan penyakit ini adalah :
1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10
LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
Extracorporeal membrane oxygenation.
o Pengobatan simptomatik :
Antiseptik didaerah mulut
Analgesik misal parasetamol
Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.
PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)
UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.
Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari
Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.
Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.
Diagnosis Banding : Varisela, herpes
Terapi : Simptomatis
"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.
EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.
GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :
o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.
Komplikasi penyakit ini adalah :
o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )
Satu kelompok dengan penyakit ini adalah :
1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10
LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
Extracorporeal membrane oxygenation.
o Pengobatan simptomatik :
Antiseptik didaerah mulut Analgesik misal parasetamol Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.
PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)
UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.
Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari
Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.
Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.
Diagnosis Banding : Varisela, herpes
Terapi : Simptomatis

---o0o---

Label: , ,

Buka kaca mobil anda sebelum berkendaran !!!

Jika Anda seorang yg mengendarai mobil silakan buka jendela
setelah Anda masuk mobil dan jangan terburu-buru menyalakan
AC. Hal ini dilakukan agar udara yg ada di dalam mobil bisa
segera keluar dan tergantikan dengan udara yg lebih segar.
Ternyata udara yg ada di dalam mobil (saat diparkir)
mengandung Benzene/Bensol. Darimanakah Benzene ini berasal??

Menurut penelitian yang dilakukan oleh UC, dashboard mobil,
sofa, air freshener akan memancarkan Benzene, hal ini bisa
disebabkan oleh suhu ruangan yg meninggi. (hati2 bila
mencium bau plastik terbakar di dalam mobil anda, segera cek
asal bau tersebut). Kalau tidak salah saya pernah membaca
thread tentang bahaya action figure yg kebakar di dalam
mobil.. Artikel ini berhubungan dengan thread tersebut (maaf
sampai sekarang saya belum bisa menemukan thread tersebut).

Tingkat Benzene yang dapat diterima dalam ruangan adalah 50?
mg per sq ft. Sebuah mobil yg parkir di ruangan dengan?
jendela tertutup akan berisi 400-800 mg dari Benzene. Jika?
parkir di luar rumah di bawah sinar matahari pada suhu di?
atas 60 derajat F, tingkat Benzene berjalan sampai 2000-4000?
mg, 40 kali dengan tingkat yang dapat diterima ..?
Orang-orang di dalam mobil pasti akan menyedot kelebihan?
jumlah toksin.?

***Bahaya Benzene...***

Efek singkat menghirup high level benzene dapat
mengakibatkan kematian, sedangkan menghirup low level
benzene dapat menyebabkan kantuk, pusing, mempercepat denyut
jantung, sakit kepala, tremors, kebingungan, dan ketidaksadaran.

Long term efeknya bisa menyebabkan kerusakan pada sumsum tulang
dan dapat menyebabkan penurunan sel darah merah, yang
mengarah ke anemia. Ia juga dapat menyebabkan perdarahan
yang berlebihan dan menurunkan system kekebalan,
meningkatkan kesempatan infeksi, menyebabkan leukemia dan
lainnya yang terkait dengan kanker darah dan pra-kanker dari darah.**

Benzene adalah toksin yang menyerang hati, ginjal,
paru-paru, jantung dan otak dan dapat menyebabkan kerusakan
kromosonal. Saat ini sedang diadakan penelitian tentang
pengaruh benzene terhadap tingkat kesuburan pria dan wanita.**?

Benzene adalah racun yg berbahaya karena tubuh kita kesulitan untuk
mengeluarkan jenis racun* ini.*?

Karena itu sangat disarankan agar Anda membuka jendela dan pintu untuk?
memberikan waktu pada udara yg ada di dalam agar keluar,
sebelum Anda masuk.*?

Semoga bermanfaat.. ..?

Label: , ,

Rabu, 01 April 2009

OHSAS 18001:2007

Standar OHSAS 18001:2007 yang dipublikasikan pada bulan Juli 2007 ini lebih
berorientasi kepada hasil dibandingkan dengan versi sebelumnya. Standar ini disesuaikan
dengan ISO 9001:2000 dan ISO 14001:2004, sehingga memungkinkan untuk melakukan
sistem manajemen secara terpadu.
Apa yang berubah?
Standar OHSAS yang baru sangat berbeda dengan versi sebelumnya dengan perubahan
sebagai berikut:
1. Pentingnya "kesehatan" sekarang lebih ditekankan dan diseimbangkan dengan
keselamatan".
2. Lebih fokus kepada kesehatan dan keselamatan kerja, tidak termasuk aset, keamanan,
dan lain-lain.
3. Istilah "insiden" digunakan menggantikan "kecelakaan".
4. Elemen-elemen perilaku, kemampuan dan faktor-faktor manusia lainnya harus
dipertimbangkan dalam melakukan identifikasi bahaya-bahaya, penilaian risiko,
menetapkan pengendalian risiko dan akhirnya mempertimbangkan kompetensi,
pelatihan dan kepedulian.
5. Persyaratan baru:
a. delegasi pengendalian sebagai bagian dari perencanaan K3.
b. manajemen perubahan.
c. partisipasi dan konsultasi.
d. "evaluasi kesesuaian", seperti pada ISO 14001.
e. penyelidikan kejadian.
6. OHSAS 18001 sekarang mengacu sebagai standar, bukan spesifikasi atau dokumen
seperti pada edisi sebelumnya.
7. Definisi baru ditambahkan:
a. "insiden", "risiko", "penilaian risiko", dan definisi yang sudah ada
dirubah.
b. "risiko yang dapat ditolerir" menjadi "risiko yang dapat diterima".
definisi istilah "bahaya" tidak lagi mengacu kepada "kerusakan
properti atau kerusakan kepada lingkungan kerja".
"Kerusakan" tidak secara langsung berhubungan dengan manaje-
men kesehatan dan keselamatan kerja, melainkan termasuk da-
lam manajemen aset.
Secara ringkas, OHSAS 18001:2007 lebih kompatibel dengan ISO 14001:2004 dan ISO
9001:2000.
Periode transisi selama dua tahun
Organisasi yang telah mendapatkan sertifikat OHSAS 18001 memiliki masa transisi
selama dua tahun sampai dengan 1 Juli 2009. Organisasi sebaiknya segera menerapkan
peningkatan dan penyesuaian dan mendapatkan manfaat dari perubahan standar baru ini.
Perlu diperhatikan bahwa OHSAS 18001:2007 bukan merupakan obat yang dapat
menyelesaikan semua masalah kesehatan dan keselamatan kerja di suatu perusahaan,
namun merupakan cara yang baik yang diterima secara global dalam memperbaiki
lingkungan kerja dan peningkatan berkelanjutan melalui suatu sistem manajemen yang
terpadu.
OHSAS 18001 dapat diadopsi oleh setiap organisasi yang ingin menerapkan prosedur
formal untuk menurunkan tingkat risiko terkait kesehatan dan keselamatan kerja
karyawan, pelanggan dan umum.
Perbandingan OHSAS 18001:2007 dengan OHSAS 18001:1999

Label: